disA [2018-03-29 17:55:47]

DNA integrity scanning protein, diadenylate cyclase, delays sporulation in the case of chromosome damage, the DisA-dependent checkpoint arrests DNA replication during B. subtilis spore outgrowth until the germinating spores genome is free of damage

Locus: BSU00880

Isoelectric point: 5.57

Molecular weight: 40.58 kDa

Protein length: 360 aa

Gene length: 1080 bp

Function: control of sporulation initiation

Product: DNA integrity scanning protein, has diadenylate cyclase activity

Essential: no

E.C.: 2.7.7.85

Synonyms: yacK

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell division → Other genes
• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Lifestyles → Sporulation → Sporulation/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Cell envelope stress proteins (controlled by SigM, V, W, X, Y)
• Lifestyles → Coping with stress → Heat shock proteins

Gene

Coordinates: 107,476 → 108,558

Phenotypes of a mutant

• a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed
• reduced spore survival after infrared exposure PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-AMP from two molecules of ATP PubMed

Protein family

• disA family (according to Swiss-Prot)

Domains

• contains a DAC domain for the synthesis of c-di-AMP PubMed

Effectors of protein activity

• RadA is an inhibitor of DisA activity PubMed
• the presence of potassium results in enhanced activity PubMed

Structure

• 3C23 PubMed

Localization

• see a video showing the movement of DisA in the cell (in real time) PubMed
• forms discrete globular foci in germinating spres that colocalize with the nucleoid PubMed

Additional information

• subject to Clp-dependent proteolysis upon glucose starvation PubMed

Expression and Regulation

Operons

• Genes: ctsR-mcsA-mcsB-clpC-radA-disA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon
  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • expressed during germination and spore outgrowth PubMed
  • induction during diamide stress (Spx) PubMed

• Genes: disA
  Description: PubMed

  Regulation

  • expressed during germination and spore outgrowth PubMed

Biological materials

Mutant

• MGNA-B932 (yacK::erm), available at the NBRP B. subtilis, Japan
• GP2142 (disA::tet), available in Jörg Stülke's lab
• BKG2 (radA-disA::spc), available in Jörg Stülke's lab
• 1A939 ( disA::tet), PubMed, available at BGSC
• GP2222 (cdaA::cat cdaS::ermC disA::tet), available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMed
• BKE00880 (ΔdisA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
• BKK00880 (ΔdisA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
• GP2715 (disA::spc), available in Jörg Stülke's lab

Expression vector

• IPTG inducible expression of His-disA in E. coli: pGP2563 (in pET19b), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Fabian Commichau's lab

References

Reviews

Loading

Original publications

Loading